sequence similarity evidence match to sequence model evidence A type of sequence similarity evidence in which the function of a gene product is predicted based on a sequence-based statistical model. eco ECO:0000202 Used when evidence from any kind of statistical model of a sequence or group of sequences is used to make a prediction about the function of a protein or RNA. Examples of relevant evidence are: Hidden Markov Models, PROSITE motifs, and tools such as tRNASCAN. mchibucos A putative rho-independent terminator sequence (GCCTGACTACATAGATGTCAGGC) was identified at position 402-bp downstream of SMU.1882 by TransTerm (transterm.dev.java.net) program. ECO:00000063 2010-03-18T12:32:30Z