Brucellosis Ontology
271 terms(s) returned
| Term Type: | Record: 1 to 50 of 271 Records | Page: 1 of 6, First Previous Next Last | Show Records Per Page |
- AAATCGCGTCCTTGCTGGTCTGA
- BFO CLIF specification label
- BFO OWL specification label
- Contributor
- Coverage
- Creator
- Date
- Description
- Format
- GACGAACGGAATTTTTCCAATCCC
- Language
- NCBI GeneID
- NCBI LocusTag
- OBI_0000283
- OBO foundry unique label
- ObsoleteProperty
- Publisher
- Relation
- Resource Identifier
- Resource Type
- Rights Management
- Source
- Subject and Keywords
- TGCCGATCACTTAAGGGCCTTCAT
- TGCCGATCACTTAAGGGCCTTCAT
- Title
- _upper_level
- achieves_planned_objective
- actively participates in
- agent_in_compromised_process
- alternative term
- antisymmetric property
- attenuated disposition realized in
- axiom holds for all times
- bearer of at all times
- bearer of at some time
- bearer_of
- begins to exist during
- brucellosis.owl
- capable_of
- capable_of
- chromosome ID of gene
- comment
- concretized by at all times
- concretized by at some time
- concretizes at all times
- concretizes at some time
- consider
- contained_in
- contains process