Brucellosis Ontology
56 terms(s) returned
| Term Type: | Record: 1 to 50 of 56 Records | Page: 1 of 2, First Previous Next Last | Show Records Per Page |
- AAATCGCGTCCTTGCTGGTCTGA
- AMOS
- Albania
- Algeria
- Argentina
- Armenia
- Australia
- Austria
- abattoir worker role
- abortion of Brucella infected livestock
- accidental release
- acidic phagosome containing smooth Brucella
- acidification of BCV in macrophage
- acidification of smooth Brucella containing phagosome
- acquired immunity to infectious agent
- acquired immunodeficiency
- active immunization against infectious agent
- acute infection
- acute infectious disease course
- adhesion disposition
- adhesion factor
- administrating doxycycline 100mg twice a day
- administrating streptomycin 1g a day
- aerosolized Brucella
- afternoons during the course of disease
- agent_in_compromised_process
- air-borne transmission process
- amebiasis
- amino acid sequence data
- aminoglycoside
- amplification product of brucellosis PCR assay
- animal dealer role
- animal disease surveillance
- animal husbandary
- antibacterial disposition
- antibiotic
- antibiotic brucellosis treatment
- antibiotic resistance
- antifungal
- antifungal disposition
- antimicrobial
- antimicrobial disposition
- antimicrobial peptide
- antiparasitic
- antiparasitic disposition
- antiseptic
- antiseptic role
- antiviral
- antiviral disposition
- apoptotic macrophage cell death
